downstream primers Search Results


92
Cell Signaling Technology Inc cebpap30 p30
Cebpap30 P30, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cebpap30 p30/product/Cell Signaling Technology Inc
Average 92 stars, based on 1 article reviews
cebpap30 p30 - by Bioz Stars, 2026-06
92/100 stars
  Buy from Supplier

91
Cell Signaling Technology Inc logmar
Logmar, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/logmar/product/Cell Signaling Technology Inc
Average 91 stars, based on 1 article reviews
logmar - by Bioz Stars, 2026-06
91/100 stars
  Buy from Supplier

90
Sigma-Genosys upstream (27-bp) and downstream (29-bp) primers
Upstream (27 Bp) And Downstream (29 Bp) Primers, supplied by Sigma-Genosys, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/upstream (27-bp) and downstream (29-bp) primers/product/Sigma-Genosys
Average 90 stars, based on 1 article reviews
upstream (27-bp) and downstream (29-bp) primers - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Beijing TransGen Biotech upstream and downstream primers
Upstream And Downstream Primers, supplied by Beijing TransGen Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/upstream and downstream primers/product/Beijing TransGen Biotech
Average 90 stars, based on 1 article reviews
upstream and downstream primers - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GeNOsys Inc primers upstream 5′ ccgtgcttcgtgctttggacta 3′ downstream 5′ agaggggtgcat gcttgggttc
Primers Upstream 5′ Ccgtgcttcgtgctttggacta 3′ Downstream 5′ Agaggggtgcat Gcttgggttc, supplied by GeNOsys Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primers upstream 5′ ccgtgcttcgtgctttggacta 3′ downstream 5′ agaggggtgcat gcttgggttc/product/GeNOsys Inc
Average 90 stars, based on 1 article reviews
primers upstream 5′ ccgtgcttcgtgctttggacta 3′ downstream 5′ agaggggtgcat gcttgggttc - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
PrimerDesign Inc downstream primers
Downstream Primers, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/downstream primers/product/PrimerDesign Inc
Average 90 stars, based on 1 article reviews
downstream primers - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Promega downstream control primer
Downstream Control Primer, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/downstream control primer/product/Promega
Average 90 stars, based on 1 article reviews
downstream control primer - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
UniTaq Bio f1-unitaq bi-q-unitaq a1i-upstream target-snp1-downstream target-unitaq bi′-univ.primer u2′
F1 Unitaq Bi Q Unitaq A1i Upstream Target Snp1 Downstream Target Unitaq Bi′ Univ.Primer U2′, supplied by UniTaq Bio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/f1-unitaq bi-q-unitaq a1i-upstream target-snp1-downstream target-unitaq bi′-univ.primer u2′/product/UniTaq Bio
Average 90 stars, based on 1 article reviews
f1-unitaq bi-q-unitaq a1i-upstream target-snp1-downstream target-unitaq bi′-univ.primer u2′ - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
SeqWright primers located about upstream and downstream from the h275 residue
Pyrogram sequence results at residue <t>H275</t> (highlighted) representing either oseltamivir-susceptible codon (CAC, underlined) (A) or oseltamivir-resistant codon (TAC, underlined) (B). The letters listed below the peaks of each panel are the nucleotides dispensed during pyrosequencing on the PyroMark ID system.
Primers Located About Upstream And Downstream From The H275 Residue, supplied by SeqWright, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primers located about upstream and downstream from the h275 residue/product/SeqWright
Average 90 stars, based on 1 article reviews
primers located about upstream and downstream from the h275 residue - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Immunotec inc downstream primer 5'-gcctctagaaatcagagtttgagt-3
Pyrogram sequence results at residue <t>H275</t> (highlighted) representing either oseltamivir-susceptible codon (CAC, underlined) (A) or oseltamivir-resistant codon (TAC, underlined) (B). The letters listed below the peaks of each panel are the nucleotides dispensed during pyrosequencing on the PyroMark ID system.
Downstream Primer 5' Gcctctagaaatcagagtttgagt 3, supplied by Immunotec inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/downstream primer 5'-gcctctagaaatcagagtttgagt-3/product/Immunotec inc
Average 90 stars, based on 1 article reviews
downstream primer 5'-gcctctagaaatcagagtttgagt-3 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GeNOsys Inc downstream primer 59-gaagggacaccctttcacat-39
Pyrogram sequence results at residue <t>H275</t> (highlighted) representing either oseltamivir-susceptible codon (CAC, underlined) (A) or oseltamivir-resistant codon (TAC, underlined) (B). The letters listed below the peaks of each panel are the nucleotides dispensed during pyrosequencing on the PyroMark ID system.
Downstream Primer 59 Gaagggacaccctttcacat 39, supplied by GeNOsys Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/downstream primer 59-gaagggacaccctttcacat-39/product/GeNOsys Inc
Average 90 stars, based on 1 article reviews
downstream primer 59-gaagggacaccctttcacat-39 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Promega hpxr-r specific downstream primer
Pyrogram sequence results at residue <t>H275</t> (highlighted) representing either oseltamivir-susceptible codon (CAC, underlined) (A) or oseltamivir-resistant codon (TAC, underlined) (B). The letters listed below the peaks of each panel are the nucleotides dispensed during pyrosequencing on the PyroMark ID system.
Hpxr R Specific Downstream Primer, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/hpxr-r specific downstream primer/product/Promega
Average 90 stars, based on 1 article reviews
hpxr-r specific downstream primer - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

Image Search Results


Pyrogram sequence results at residue H275 (highlighted) representing either oseltamivir-susceptible codon (CAC, underlined) (A) or oseltamivir-resistant codon (TAC, underlined) (B). The letters listed below the peaks of each panel are the nucleotides dispensed during pyrosequencing on the PyroMark ID system.

Journal: Diagnostic Microbiology and Infectious Disease

Article Title: Reverse-transcription polymerase chain reaction/pyrosequencing to characterize neuraminidase H275 residue of influenza A 2009 H1N1 virus for rapid and specific detection of the viral oseltamivir resistance marker in a clinical laboratory

doi: 10.1016/j.diagmicrobio.2011.09.003

Figure Lengend Snippet: Pyrogram sequence results at residue H275 (highlighted) representing either oseltamivir-susceptible codon (CAC, underlined) (A) or oseltamivir-resistant codon (TAC, underlined) (B). The letters listed below the peaks of each panel are the nucleotides dispensed during pyrosequencing on the PyroMark ID system.

Article Snippet: Two pairs of primers located about 200 bp upstream and downstream from the H275 residue were developed by SeqWright (Houston, TX, USA) for both RT-PCR and Sanger sequencing.

Techniques: Sequencing, Residue

Alignment of representative sequences by Sanger method (as “S”) and sequences by RT-PCR-pyroseq method (as “P”) to the reference sequence (CA04, GenBank number: 22780 9833: 620-1058, as described in ). Two clustered mutation residues, N248 (A248) and H275, are underlined and highlighted. Of the 16 nonclustered mutations detected in the Sanger sequencing, 2 nearest to the H275 residue from either direction are shown here (highlighted only).

Journal: Diagnostic Microbiology and Infectious Disease

Article Title: Reverse-transcription polymerase chain reaction/pyrosequencing to characterize neuraminidase H275 residue of influenza A 2009 H1N1 virus for rapid and specific detection of the viral oseltamivir resistance marker in a clinical laboratory

doi: 10.1016/j.diagmicrobio.2011.09.003

Figure Lengend Snippet: Alignment of representative sequences by Sanger method (as “S”) and sequences by RT-PCR-pyroseq method (as “P”) to the reference sequence (CA04, GenBank number: 22780 9833: 620-1058, as described in ). Two clustered mutation residues, N248 (A248) and H275, are underlined and highlighted. Of the 16 nonclustered mutations detected in the Sanger sequencing, 2 nearest to the H275 residue from either direction are shown here (highlighted only).

Article Snippet: Two pairs of primers located about 200 bp upstream and downstream from the H275 residue were developed by SeqWright (Houston, TX, USA) for both RT-PCR and Sanger sequencing.

Techniques: Reverse Transcription Polymerase Chain Reaction, Sequencing, Mutagenesis, Residue

Sensitivity testing of the RT-PCR-pyroseq method on 10-fold dilutions using real-time PCR Ct values in pandemic 2009 H1N1 virus identification as references

Journal: Diagnostic Microbiology and Infectious Disease

Article Title: Reverse-transcription polymerase chain reaction/pyrosequencing to characterize neuraminidase H275 residue of influenza A 2009 H1N1 virus for rapid and specific detection of the viral oseltamivir resistance marker in a clinical laboratory

doi: 10.1016/j.diagmicrobio.2011.09.003

Figure Lengend Snippet: Sensitivity testing of the RT-PCR-pyroseq method on 10-fold dilutions using real-time PCR Ct values in pandemic 2009 H1N1 virus identification as references

Article Snippet: Two pairs of primers located about 200 bp upstream and downstream from the H275 residue were developed by SeqWright (Houston, TX, USA) for both RT-PCR and Sanger sequencing.

Techniques: Real-time Polymerase Chain Reaction, Virus, Sequencing

Specificity of the RT-PCR-pyroseq method for detection of 2009 H1N1 neuraminidase  residue H275  sequences <xref ref-type= a " width="100%" height="100%">

Journal: Diagnostic Microbiology and Infectious Disease

Article Title: Reverse-transcription polymerase chain reaction/pyrosequencing to characterize neuraminidase H275 residue of influenza A 2009 H1N1 virus for rapid and specific detection of the viral oseltamivir resistance marker in a clinical laboratory

doi: 10.1016/j.diagmicrobio.2011.09.003

Figure Lengend Snippet: Specificity of the RT-PCR-pyroseq method for detection of 2009 H1N1 neuraminidase residue H275 sequences a

Article Snippet: Two pairs of primers located about 200 bp upstream and downstream from the H275 residue were developed by SeqWright (Houston, TX, USA) for both RT-PCR and Sanger sequencing.

Techniques: Residue, Amplification, Sequencing, Virus, Negative Control